SubtiBank SubtiBank
Version comparison:

2018-02-11 19:22:242025-05-27 03:38:28

description

ATP-dependent dsDNA translocase, resolution of chromosomal dimers after DNA replication, transports the forespore chromosome across the sporulation septum

ATP-dependent dsDNA translocase, resolution of chromosomal dimers after [SW|DNA replication], transports the forespore chromosome across the [SW|sporulation] septum

locus

BSU16800

BSU_16800

proteinLength

787

789

geneLength

2361

2370

function

chromosome partition during sporulation

chromosome partition during [SW|sporulation]

outlinks

bsu

BSU16800

BSU_16800

Gene

Coordinates

1,752,272 → 1,754,641

1,752,272 1,754,641

The protein

Catalyzed reaction/ biological activity

transports the forespore chromosome across the sporulation septum [Pubmed|20516200]

translocates septum-entrapped DNA only when septum closure precedes complete segregation of chromosomes [Pubmed|19818024]

the two DNA translocases [[protein|SftA]] and [[protein|SpoIIIE]] synergistically affect chromosome dimer resolution presumably by positioning the dif sites in close proximity, before or after completion of cell division, respectively [Pubmed|21239579]

binds DNA sequences named SRS for SpoIIIE recognition sequence, GAGAAGGG [Pubmed|18391964]

transports the forespore chromosome across the [SW|sporulation ]septum [Pubmed|20516200]

translocates septum-entrapped DNA only when septum closure precedes complete segregation of chromosomes [Pubmed|19818024]

the two DNA translocases [[protein|SftA]] and [[protein|SpoIIIE]] synergistically affect chromosome dimer resolution presumably by positioning the dif sites in close proximity, before or after completion of cell division, respectively [Pubmed|21239579]

binds DNA sequences named SRS for SpoIIIE recognition sequence, GAGAAGGG [Pubmed|18391964]

The protein

Paralogous protein(s)

[[protein|SftA]]

[[this]]

The protein

[SW|Domains]

N-terminal transmembrane domain (4 helices) [Pubmed|24297254]

134 aa linker [Pubmed|24297254]

512 aa motor domain at the C-terminus [Pubmed|24297254]

N-terminal transmembrane domain (4 helices) [Pubmed|24297254]

134 aa linker [Pubmed|24297254]

512 aa motor domain at the C-terminus [Pubmed|24297254]

[SW|FtsK domain] (aa 450-646) (according to UniProt)

The protein

[SW|Localization]

transmembrane domain mediates dynamic localization to active division sites [Pubmed|20516200]

complexes are recruited to nascent sites of septation, and are subsequently escorted by the constriction machinery to the center of [SW|sporulation] and division septa [Pubmed|23667326]

free diffusion in the membrane, no enrichment at septa [pubmed|29439991]

transmembrane domain mediates dynamic localization to active division sites [Pubmed|20516200]

complexes are recruited to nascent sites of septation, and are subsequently escorted by the constriction machinery to the center of [SW|sporulation] and division septa [Pubmed|23667326]

Biological materials

Mutant

BKE16800 (Δ[[gene|spoIIIE]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATCACCTTACTGC, downstream forward: _UP4_TAATGAAGGGAGTTCCGCTT

BKK16800 (Δ[[gene|spoIIIE]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATCACCTTACTGC, downstream forward: _UP4_TAATGAAGGGAGTTCCGCTT

BKE16800 ([[gene|spoIIIE]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATCACCTTACTGC, downstream forward: _UP4_TAATGAAGGGAGTTCCGCTT

BKK16800 ([[gene|spoIIIE]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTCATCACCTTACTGC, downstream forward: _UP4_TAATGAAGGGAGTTCCGCTT

References

Reviews

22047950, 22934648, 23400100, 25460803

22047950, 22934648, 23400100, 25460803, 32660383

References

Original publications

18160039, 18593879, 3129532, 2507870, 18593879, 23559069, 9150232, 2492502, 11062134, 9155041, 14680637, 7797072, 7567988, 2507870, 8160014, 9515703, 19818024, 19788545, 20298190, 20516200, 21239579, 18391964, 23667326, 11134515, 24297254, 24769697, 25950186, 26452092, 16916635, 26849443, 27886417, 27891124

29439991, 18160039, 18593879, 3129532, 2507870, 18593879, 23559069, 9150232, 2492502, 11062134, 9155041, 14680637, 7797072, 7567988, 2507870, 8160014, 9515703, 19818024, 19788545, 20298190, 20516200, 21239579, 18391964, 23667326, 11134515, 24297254, 24769697, 25950186, 26452092, 16916635, 26849443, 27886417, 27891124, 29425492, 29504934, 29588476, 32778559

The protein

Protein family

FtsK/SpoIIIE/SftA family (with [[protein|SftA]], according to UniProt)